Obsidian’s The Outer Worlds blends Firefly and Fallout into a bold, open-ended sci-fi RPG

hallownest:

From the article:

  • Your protagonist isn’t voiced
  • There’s a special class of “science weapons” that will have special, ridiculous effects, like a shrink ray
  • There’s a full character creator even though it’s first-person only (you’ll see your character in the inventory, and if you leave the game idling long)
  • Your companions don’t have separate inventories. Taking companions with you just gives you more inventory space to work with yourself
  • If companions really dislike the decisions you make, they’ll leave and go back to the ship. You can persuade them to see things your way
  • No romancing companions. They considered it, but decided against it.
  • Companions each have a special attack (one named Felix does a double drop kick) but you can also equip them with whatever weapons you want
  • Hacking and lockpicking don’t have minigames, and are simply based on your attributes
  • There are six skills (strength, intelligence etc.) and for every 20 points you put into one (up until 100) you’ll gain a new perk
  • As in the creators’ past games, you can play as a “dumb” character with stupid dialogue options. Your companions react appropriately.
  • They’re still not sure if it will be possible to play through the game completely pacifist (but you’ll almost definitely have to at least kill some robots)
  • Robots aren’t sentient, but your ship’s AI seems to have a strange degree of personality
  • Tim Cain wants you to know there are a lot of drugs, but he’s not going to pressure you to take them

Obsidian’s The Outer Worlds blends Firefly and Fallout into a bold, open-ended sci-fi RPG

anneuaidd:

anneuaidd:

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

Why is this being tagged as homestuck

nightmaresyrup:

FYI I’m not leaving the site unless it completely gets shutdown. Uggh… the whole damn thing is idiotic and unfair to be honest. The site may have removed any evidence of the illegal thing that can be shown to the proper authorities. It just saved their reputation, not the victim of the illegal thing. 

Well, I’m staying because this is where I met a METRIC HEAPING TON of cool friends, and I’m curious to see what takes over.